ID: 1040299883

View in Genome Browser
Species Human (GRCh38)
Location 8:46182452-46182474
Sequence AGTTCCCCAGAATTTGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040299883_1040299894 12 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299894 8:46182487-46182509 GGACAGACCTGGGGGCTTCTGGG No data
1040299883_1040299895 17 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299895 8:46182492-46182514 GACCTGGGGGCTTCTGGGATAGG No data
1040299883_1040299890 3 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299890 8:46182478-46182500 GCCTGTCTGGGACAGACCTGGGG No data
1040299883_1040299898 30 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299898 8:46182505-46182527 CTGGGATAGGAGAGGCCTTTTGG No data
1040299883_1040299887 -9 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299887 8:46182466-46182488 TGGGGAACTACAGCCTGTCTGGG No data
1040299883_1040299886 -10 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299886 8:46182465-46182487 CTGGGGAACTACAGCCTGTCTGG No data
1040299883_1040299892 4 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299892 8:46182479-46182501 CCTGTCTGGGACAGACCTGGGGG No data
1040299883_1040299888 1 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299888 8:46182476-46182498 CAGCCTGTCTGGGACAGACCTGG No data
1040299883_1040299893 11 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299893 8:46182486-46182508 GGGACAGACCTGGGGGCTTCTGG No data
1040299883_1040299889 2 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299889 8:46182477-46182499 AGCCTGTCTGGGACAGACCTGGG No data
1040299883_1040299897 22 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299897 8:46182497-46182519 GGGGGCTTCTGGGATAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040299883 Original CRISPR AGTTCCCCAGAATTTGGAGG TGG (reversed) Intergenic