ID: 1040299885

View in Genome Browser
Species Human (GRCh38)
Location 8:46182458-46182480
Sequence GGCTGTAGTTCCCCAGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040299885_1040299895 11 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299895 8:46182492-46182514 GACCTGGGGGCTTCTGGGATAGG No data
1040299885_1040299892 -2 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299892 8:46182479-46182501 CCTGTCTGGGACAGACCTGGGGG No data
1040299885_1040299897 16 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299897 8:46182497-46182519 GGGGGCTTCTGGGATAGGAGAGG No data
1040299885_1040299889 -4 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299889 8:46182477-46182499 AGCCTGTCTGGGACAGACCTGGG No data
1040299885_1040299900 26 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299900 8:46182507-46182529 GGGATAGGAGAGGCCTTTTGGGG No data
1040299885_1040299893 5 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299893 8:46182486-46182508 GGGACAGACCTGGGGGCTTCTGG No data
1040299885_1040299888 -5 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299888 8:46182476-46182498 CAGCCTGTCTGGGACAGACCTGG No data
1040299885_1040299898 24 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299898 8:46182505-46182527 CTGGGATAGGAGAGGCCTTTTGG No data
1040299885_1040299894 6 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299894 8:46182487-46182509 GGACAGACCTGGGGGCTTCTGGG No data
1040299885_1040299890 -3 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299890 8:46182478-46182500 GCCTGTCTGGGACAGACCTGGGG No data
1040299885_1040299899 25 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299899 8:46182506-46182528 TGGGATAGGAGAGGCCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040299885 Original CRISPR GGCTGTAGTTCCCCAGAATT TGG (reversed) Intergenic
No off target data available for this crispr