ID: 1040299886

View in Genome Browser
Species Human (GRCh38)
Location 8:46182465-46182487
Sequence CTGGGGAACTACAGCCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040299882_1040299886 -9 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299886 8:46182465-46182487 CTGGGGAACTACAGCCTGTCTGG No data
1040299883_1040299886 -10 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299886 8:46182465-46182487 CTGGGGAACTACAGCCTGTCTGG No data
1040299878_1040299886 13 Left 1040299878 8:46182429-46182451 CCATCTGTGAGAGACACTGGCAC No data
Right 1040299886 8:46182465-46182487 CTGGGGAACTACAGCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040299886 Original CRISPR CTGGGGAACTACAGCCTGTC TGG Intergenic
No off target data available for this crispr