ID: 1040299897

View in Genome Browser
Species Human (GRCh38)
Location 8:46182497-46182519
Sequence GGGGGCTTCTGGGATAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040299891_1040299897 -5 Left 1040299891 8:46182479-46182501 CCTGTCTGGGACAGACCTGGGGG No data
Right 1040299897 8:46182497-46182519 GGGGGCTTCTGGGATAGGAGAGG No data
1040299883_1040299897 22 Left 1040299883 8:46182452-46182474 CCACCTCCAAATTCTGGGGAACT No data
Right 1040299897 8:46182497-46182519 GGGGGCTTCTGGGATAGGAGAGG No data
1040299885_1040299897 16 Left 1040299885 8:46182458-46182480 CCAAATTCTGGGGAACTACAGCC No data
Right 1040299897 8:46182497-46182519 GGGGGCTTCTGGGATAGGAGAGG No data
1040299882_1040299897 23 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299897 8:46182497-46182519 GGGGGCTTCTGGGATAGGAGAGG No data
1040299884_1040299897 19 Left 1040299884 8:46182455-46182477 CCTCCAAATTCTGGGGAACTACA No data
Right 1040299897 8:46182497-46182519 GGGGGCTTCTGGGATAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040299897 Original CRISPR GGGGGCTTCTGGGATAGGAG AGG Intergenic
No off target data available for this crispr