ID: 1040300836

View in Genome Browser
Species Human (GRCh38)
Location 8:46187216-46187238
Sequence CAGTGAGACCACAGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040300836_1040300843 21 Left 1040300836 8:46187216-46187238 CCAGCATCCCTGTGGTCTCACTG No data
Right 1040300843 8:46187260-46187282 AACGTCACCCTGAGTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040300836 Original CRISPR CAGTGAGACCACAGGGATGC TGG (reversed) Intergenic
No off target data available for this crispr