ID: 1040301909

View in Genome Browser
Species Human (GRCh38)
Location 8:46192408-46192430
Sequence GGTGGGCCTTAGAAACTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040301901_1040301909 12 Left 1040301901 8:46192373-46192395 CCACAACAGTGAAAACAGAGCTG No data
Right 1040301909 8:46192408-46192430 GGTGGGCCTTAGAAACTCAGGGG No data
1040301900_1040301909 13 Left 1040301900 8:46192372-46192394 CCCACAACAGTGAAAACAGAGCT No data
Right 1040301909 8:46192408-46192430 GGTGGGCCTTAGAAACTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040301909 Original CRISPR GGTGGGCCTTAGAAACTCAG GGG Intergenic
No off target data available for this crispr