ID: 1040305759

View in Genome Browser
Species Human (GRCh38)
Location 8:46210988-46211010
Sequence GGATTGTTTGGGAGAGACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040305759_1040305767 2 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305767 8:46211013-46211035 ACAAGCGAAAACAGGGCTGCAGG No data
1040305759_1040305770 11 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305770 8:46211022-46211044 AACAGGGCTGCAGGGTGGTGTGG No data
1040305759_1040305771 12 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305771 8:46211023-46211045 ACAGGGCTGCAGGGTGGTGTGGG No data
1040305759_1040305774 27 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305774 8:46211038-46211060 GGTGTGGGAGGGCCACAGTGTGG No data
1040305759_1040305768 3 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305768 8:46211014-46211036 CAAGCGAAAACAGGGCTGCAGGG No data
1040305759_1040305773 16 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305773 8:46211027-46211049 GGCTGCAGGGTGGTGTGGGAGGG No data
1040305759_1040305769 6 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305769 8:46211017-46211039 GCGAAAACAGGGCTGCAGGGTGG No data
1040305759_1040305772 15 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305772 8:46211026-46211048 GGGCTGCAGGGTGGTGTGGGAGG No data
1040305759_1040305762 -6 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305762 8:46211005-46211027 CAATCCCCACAAGCGAAAACAGG No data
1040305759_1040305763 -5 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305763 8:46211006-46211028 AATCCCCACAAGCGAAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040305759 Original CRISPR GGATTGTTTGGGAGAGACAG CGG (reversed) Intergenic