ID: 1040305761

View in Genome Browser
Species Human (GRCh38)
Location 8:46211000-46211022
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040305761_1040305774 15 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305774 8:46211038-46211060 GGTGTGGGAGGGCCACAGTGTGG No data
1040305761_1040305768 -9 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305768 8:46211014-46211036 CAAGCGAAAACAGGGCTGCAGGG No data
1040305761_1040305775 20 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305775 8:46211043-46211065 GGGAGGGCCACAGTGTGGCATGG No data
1040305761_1040305776 21 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305776 8:46211044-46211066 GGAGGGCCACAGTGTGGCATGGG No data
1040305761_1040305772 3 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305772 8:46211026-46211048 GGGCTGCAGGGTGGTGTGGGAGG No data
1040305761_1040305769 -6 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305769 8:46211017-46211039 GCGAAAACAGGGCTGCAGGGTGG No data
1040305761_1040305771 0 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305771 8:46211023-46211045 ACAGGGCTGCAGGGTGGTGTGGG No data
1040305761_1040305767 -10 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305767 8:46211013-46211035 ACAAGCGAAAACAGGGCTGCAGG No data
1040305761_1040305770 -1 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305770 8:46211022-46211044 AACAGGGCTGCAGGGTGGTGTGG No data
1040305761_1040305773 4 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305773 8:46211027-46211049 GGCTGCAGGGTGGTGTGGGAGGG No data
1040305761_1040305777 25 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305777 8:46211048-46211070 GGCCACAGTGTGGCATGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040305761 Original CRISPR TTTCGCTTGTGGGGATTGTT TGG (reversed) Intergenic