ID: 1040305769

View in Genome Browser
Species Human (GRCh38)
Location 8:46211017-46211039
Sequence GCGAAAACAGGGCTGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040305761_1040305769 -6 Left 1040305761 8:46211000-46211022 CCAAACAATCCCCACAAGCGAAA No data
Right 1040305769 8:46211017-46211039 GCGAAAACAGGGCTGCAGGGTGG No data
1040305759_1040305769 6 Left 1040305759 8:46210988-46211010 CCGCTGTCTCTCCCAAACAATCC No data
Right 1040305769 8:46211017-46211039 GCGAAAACAGGGCTGCAGGGTGG No data
1040305760_1040305769 -5 Left 1040305760 8:46210999-46211021 CCCAAACAATCCCCACAAGCGAA No data
Right 1040305769 8:46211017-46211039 GCGAAAACAGGGCTGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040305769 Original CRISPR GCGAAAACAGGGCTGCAGGG TGG Intergenic