ID: 1040306039

View in Genome Browser
Species Human (GRCh38)
Location 8:46212329-46212351
Sequence CCCTGCGGCCCTGTTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040306039_1040306045 -10 Left 1040306039 8:46212329-46212351 CCAGTGAAAACAGGGCCGCAGGG No data
Right 1040306045 8:46212342-46212364 GGCCGCAGGGTGGTGTGGGAGGG No data
1040306039_1040306051 21 Left 1040306039 8:46212329-46212351 CCAGTGAAAACAGGGCCGCAGGG No data
Right 1040306051 8:46212373-46212395 ACTCAGGGTGATGTTGAAGCAGG No data
1040306039_1040306047 -7 Left 1040306039 8:46212329-46212351 CCAGTGAAAACAGGGCCGCAGGG No data
Right 1040306047 8:46212345-46212367 CGCAGGGTGGTGTGGGAGGGTGG No data
1040306039_1040306050 6 Left 1040306039 8:46212329-46212351 CCAGTGAAAACAGGGCCGCAGGG No data
Right 1040306050 8:46212358-46212380 GGGAGGGTGGCAAGGACTCAGGG No data
1040306039_1040306049 5 Left 1040306039 8:46212329-46212351 CCAGTGAAAACAGGGCCGCAGGG No data
Right 1040306049 8:46212357-46212379 TGGGAGGGTGGCAAGGACTCAGG No data
1040306039_1040306048 -2 Left 1040306039 8:46212329-46212351 CCAGTGAAAACAGGGCCGCAGGG No data
Right 1040306048 8:46212350-46212372 GGTGGTGTGGGAGGGTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040306039 Original CRISPR CCCTGCGGCCCTGTTTTCAC TGG (reversed) Intergenic
No off target data available for this crispr