ID: 1040306453

View in Genome Browser
Species Human (GRCh38)
Location 8:46214414-46214436
Sequence AGTCCTCAGTGGTGTCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040306450_1040306453 -7 Left 1040306450 8:46214398-46214420 CCTTACCAATTCGAGAAGTCCTC No data
Right 1040306453 8:46214414-46214436 AGTCCTCAGTGGTGTCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040306453 Original CRISPR AGTCCTCAGTGGTGTCCTAG TGG Intergenic