ID: 1040306765

View in Genome Browser
Species Human (GRCh38)
Location 8:46216014-46216036
Sequence CCCTGCTGCCCTGTTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040306765_1040306772 -2 Left 1040306765 8:46216014-46216036 CCAGTGAAAACAGGGCAGCAGGG No data
Right 1040306772 8:46216035-46216057 GGTGGCATGGGCTGTTGGCAGGG No data
1040306765_1040306773 17 Left 1040306765 8:46216014-46216036 CCAGTGAAAACAGGGCAGCAGGG No data
Right 1040306773 8:46216054-46216076 AGGGTCTCAGAGTGACATTGAGG No data
1040306765_1040306770 -7 Left 1040306765 8:46216014-46216036 CCAGTGAAAACAGGGCAGCAGGG No data
Right 1040306770 8:46216030-46216052 AGCAGGGTGGCATGGGCTGTTGG No data
1040306765_1040306774 21 Left 1040306765 8:46216014-46216036 CCAGTGAAAACAGGGCAGCAGGG No data
Right 1040306774 8:46216058-46216080 TCTCAGAGTGACATTGAGGCAGG No data
1040306765_1040306771 -3 Left 1040306765 8:46216014-46216036 CCAGTGAAAACAGGGCAGCAGGG No data
Right 1040306771 8:46216034-46216056 GGGTGGCATGGGCTGTTGGCAGG No data
1040306765_1040306775 27 Left 1040306765 8:46216014-46216036 CCAGTGAAAACAGGGCAGCAGGG No data
Right 1040306775 8:46216064-46216086 AGTGACATTGAGGCAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040306765 Original CRISPR CCCTGCTGCCCTGTTTTCAC TGG (reversed) Intergenic
No off target data available for this crispr