ID: 1040310801

View in Genome Browser
Species Human (GRCh38)
Location 8:46235857-46235879
Sequence GCGAAAACTGGGCCGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040310790_1040310801 29 Left 1040310790 8:46235805-46235827 CCACATAGCTTTGGAAAAGACGG No data
Right 1040310801 8:46235857-46235879 GCGAAAACTGGGCCGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040310801 Original CRISPR GCGAAAACTGGGCCGCAGGG TGG Intergenic