ID: 1040310825

View in Genome Browser
Species Human (GRCh38)
Location 8:46235986-46236008
Sequence AGGAGCCCCCAGGTCTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040310817_1040310825 22 Left 1040310817 8:46235941-46235963 CCTCAAGGAATGCTGGGAGCCTC No data
Right 1040310825 8:46235986-46236008 AGGAGCCCCCAGGTCTGTCCAGG No data
1040310820_1040310825 -1 Left 1040310820 8:46235964-46235986 CCAAAGAAAACGCTCCCATTTTA No data
Right 1040310825 8:46235986-46236008 AGGAGCCCCCAGGTCTGTCCAGG No data
1040310818_1040310825 3 Left 1040310818 8:46235960-46235982 CCTCCCAAAGAAAACGCTCCCAT No data
Right 1040310825 8:46235986-46236008 AGGAGCCCCCAGGTCTGTCCAGG No data
1040310819_1040310825 0 Left 1040310819 8:46235963-46235985 CCCAAAGAAAACGCTCCCATTTT No data
Right 1040310825 8:46235986-46236008 AGGAGCCCCCAGGTCTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040310825 Original CRISPR AGGAGCCCCCAGGTCTGTCC AGG Intergenic
No off target data available for this crispr