ID: 1040311438

View in Genome Browser
Species Human (GRCh38)
Location 8:46238867-46238889
Sequence GCGAAAACGGGGCTGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040311425_1040311438 26 Left 1040311425 8:46238818-46238840 CCAGGCTTCAGAGCAGGGTGCCT No data
Right 1040311438 8:46238867-46238889 GCGAAAACGGGGCTGCAGGGTGG No data
1040311428_1040311438 6 Left 1040311428 8:46238838-46238860 CCTGTGTCTCTCGCGGAAGGCCC No data
Right 1040311438 8:46238867-46238889 GCGAAAACGGGGCTGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040311438 Original CRISPR GCGAAAACGGGGCTGCAGGG TGG Intergenic