ID: 1040314386

View in Genome Browser
Species Human (GRCh38)
Location 8:46253300-46253322
Sequence CCCCTAAGGGTGCCCCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040314379_1040314386 -5 Left 1040314379 8:46253282-46253304 CCTCTCAAAACCCAGAAGCCCCT No data
Right 1040314386 8:46253300-46253322 CCCCTAAGGGTGCCCCTGGCAGG No data
1040314377_1040314386 5 Left 1040314377 8:46253272-46253294 CCCAAGAAAGCCTCTCAAAACCC No data
Right 1040314386 8:46253300-46253322 CCCCTAAGGGTGCCCCTGGCAGG No data
1040314378_1040314386 4 Left 1040314378 8:46253273-46253295 CCAAGAAAGCCTCTCAAAACCCA No data
Right 1040314386 8:46253300-46253322 CCCCTAAGGGTGCCCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040314386 Original CRISPR CCCCTAAGGGTGCCCCTGGC AGG Intergenic
No off target data available for this crispr