ID: 1040317390

View in Genome Browser
Species Human (GRCh38)
Location 8:46272101-46272123
Sequence CCAAGTGGGTTGTAAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040317380_1040317390 3 Left 1040317380 8:46272075-46272097 CCCATTCCAGAACCCCCTGTGAT No data
Right 1040317390 8:46272101-46272123 CCAAGTGGGTTGTAAAGCCCCGG No data
1040317386_1040317390 -10 Left 1040317386 8:46272088-46272110 CCCCTGTGATGTGCCAAGTGGGT No data
Right 1040317390 8:46272101-46272123 CCAAGTGGGTTGTAAAGCCCCGG No data
1040317382_1040317390 -3 Left 1040317382 8:46272081-46272103 CCAGAACCCCCTGTGATGTGCCA No data
Right 1040317390 8:46272101-46272123 CCAAGTGGGTTGTAAAGCCCCGG No data
1040317379_1040317390 8 Left 1040317379 8:46272070-46272092 CCTCTCCCATTCCAGAACCCCCT No data
Right 1040317390 8:46272101-46272123 CCAAGTGGGTTGTAAAGCCCCGG No data
1040317384_1040317390 -9 Left 1040317384 8:46272087-46272109 CCCCCTGTGATGTGCCAAGTGGG No data
Right 1040317390 8:46272101-46272123 CCAAGTGGGTTGTAAAGCCCCGG No data
1040317378_1040317390 21 Left 1040317378 8:46272057-46272079 CCTCACAAGCAGTCCTCTCCCAT No data
Right 1040317390 8:46272101-46272123 CCAAGTGGGTTGTAAAGCCCCGG No data
1040317381_1040317390 2 Left 1040317381 8:46272076-46272098 CCATTCCAGAACCCCCTGTGATG No data
Right 1040317390 8:46272101-46272123 CCAAGTGGGTTGTAAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040317390 Original CRISPR CCAAGTGGGTTGTAAAGCCC CGG Intergenic
No off target data available for this crispr