ID: 1040329413

View in Genome Browser
Species Human (GRCh38)
Location 8:46378316-46378338
Sequence CTTTCAGAGGGCACCCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040329409_1040329413 6 Left 1040329409 8:46378287-46378309 CCAGGCTTTGGAACAGGGTGCAT No data
Right 1040329413 8:46378316-46378338 CTTTCAGAGGGCACCCACAAGGG No data
1040329401_1040329413 26 Left 1040329401 8:46378267-46378289 CCCAGGCGGGCTGTAAAGCCCCA No data
Right 1040329413 8:46378316-46378338 CTTTCAGAGGGCACCCACAAGGG No data
1040329402_1040329413 25 Left 1040329402 8:46378268-46378290 CCAGGCGGGCTGTAAAGCCCCAG 0: 7
1: 49
2: 89
3: 104
4: 243
Right 1040329413 8:46378316-46378338 CTTTCAGAGGGCACCCACAAGGG No data
1040329408_1040329413 7 Left 1040329408 8:46378286-46378308 CCCAGGCTTTGGAACAGGGTGCA No data
Right 1040329413 8:46378316-46378338 CTTTCAGAGGGCACCCACAAGGG No data
1040329407_1040329413 8 Left 1040329407 8:46378285-46378307 CCCCAGGCTTTGGAACAGGGTGC No data
Right 1040329413 8:46378316-46378338 CTTTCAGAGGGCACCCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040329413 Original CRISPR CTTTCAGAGGGCACCCACAA GGG Intergenic
No off target data available for this crispr