ID: 1040329671

View in Genome Browser
Species Human (GRCh38)
Location 8:46379443-46379465
Sequence GGCCATGCAGAACACCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040329671_1040329679 29 Left 1040329671 8:46379443-46379465 CCCCAGGGGTGTTCTGCATGGCC No data
Right 1040329679 8:46379495-46379517 GAAAACCCCCTCAAGTGCAAAGG No data
1040329671_1040329680 30 Left 1040329671 8:46379443-46379465 CCCCAGGGGTGTTCTGCATGGCC No data
Right 1040329680 8:46379496-46379518 AAAACCCCCTCAAGTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040329671 Original CRISPR GGCCATGCAGAACACCCCTG GGG (reversed) Intergenic
No off target data available for this crispr