ID: 1040331180

View in Genome Browser
Species Human (GRCh38)
Location 8:46386548-46386570
Sequence GCGAAAACGGGGCTGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040331171_1040331180 -4 Left 1040331171 8:46386529-46386551 CCAAGGTAGGCCCCTACAAGCGA No data
Right 1040331180 8:46386548-46386570 GCGAAAACGGGGCTGCAGGGTGG No data
1040331170_1040331180 -3 Left 1040331170 8:46386528-46386550 CCCAAGGTAGGCCCCTACAAGCG No data
Right 1040331180 8:46386548-46386570 GCGAAAACGGGGCTGCAGGGTGG No data
1040331169_1040331180 6 Left 1040331169 8:46386519-46386541 CCTGTGTCTCCCAAGGTAGGCCC No data
Right 1040331180 8:46386548-46386570 GCGAAAACGGGGCTGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040331180 Original CRISPR GCGAAAACGGGGCTGCAGGG TGG Intergenic