ID: 1040332979

View in Genome Browser
Species Human (GRCh38)
Location 8:46401714-46401736
Sequence TGGGTGGGGGCTAGAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040332979_1040332995 16 Left 1040332979 8:46401714-46401736 CCTGAGCCTCTAGCCCCCACCCA No data
Right 1040332995 8:46401753-46401775 GGAGAATTCTGAGAAAGGAGAGG No data
1040332979_1040332990 -5 Left 1040332979 8:46401714-46401736 CCTGAGCCTCTAGCCCCCACCCA No data
Right 1040332990 8:46401732-46401754 ACCCAGAGGGGGGAGCACCATGG No data
1040332979_1040332993 11 Left 1040332979 8:46401714-46401736 CCTGAGCCTCTAGCCCCCACCCA No data
Right 1040332993 8:46401748-46401770 ACCATGGAGAATTCTGAGAAAGG No data
1040332979_1040332996 29 Left 1040332979 8:46401714-46401736 CCTGAGCCTCTAGCCCCCACCCA No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040332979 Original CRISPR TGGGTGGGGGCTAGAGGCTC AGG (reversed) Intergenic
No off target data available for this crispr