ID: 1040332989

View in Genome Browser
Species Human (GRCh38)
Location 8:46401730-46401752
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040332989_1040332995 0 Left 1040332989 8:46401730-46401752 CCACCCAGAGGGGGGAGCACCAT No data
Right 1040332995 8:46401753-46401775 GGAGAATTCTGAGAAAGGAGAGG No data
1040332989_1040332996 13 Left 1040332989 8:46401730-46401752 CCACCCAGAGGGGGGAGCACCAT No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332989_1040332993 -5 Left 1040332989 8:46401730-46401752 CCACCCAGAGGGGGGAGCACCAT No data
Right 1040332993 8:46401748-46401770 ACCATGGAGAATTCTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040332989 Original CRISPR ATGGTGCTCCCCCCTCTGGG TGG (reversed) Intergenic
No off target data available for this crispr