ID: 1040332992

View in Genome Browser
Species Human (GRCh38)
Location 8:46401734-46401756
Sequence CTCCATGGTGCTCCCCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040332992_1040332993 -9 Left 1040332992 8:46401734-46401756 CCAGAGGGGGGAGCACCATGGAG No data
Right 1040332993 8:46401748-46401770 ACCATGGAGAATTCTGAGAAAGG No data
1040332992_1040332996 9 Left 1040332992 8:46401734-46401756 CCAGAGGGGGGAGCACCATGGAG No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332992_1040333000 27 Left 1040332992 8:46401734-46401756 CCAGAGGGGGGAGCACCATGGAG No data
Right 1040333000 8:46401784-46401806 TGAGGATCCAGCACCCATTCAGG No data
1040332992_1040332995 -4 Left 1040332992 8:46401734-46401756 CCAGAGGGGGGAGCACCATGGAG No data
Right 1040332995 8:46401753-46401775 GGAGAATTCTGAGAAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040332992 Original CRISPR CTCCATGGTGCTCCCCCCTC TGG (reversed) Intergenic
No off target data available for this crispr