ID: 1040332994

View in Genome Browser
Species Human (GRCh38)
Location 8:46401749-46401771
Sequence TCCTTTCTCAGAATTCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040332994_1040332996 -6 Left 1040332994 8:46401749-46401771 CCATGGAGAATTCTGAGAAAGGA No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332994_1040333001 17 Left 1040332994 8:46401749-46401771 CCATGGAGAATTCTGAGAAAGGA No data
Right 1040333001 8:46401789-46401811 ATCCAGCACCCATTCAGGCCTGG No data
1040332994_1040333000 12 Left 1040332994 8:46401749-46401771 CCATGGAGAATTCTGAGAAAGGA No data
Right 1040333000 8:46401784-46401806 TGAGGATCCAGCACCCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040332994 Original CRISPR TCCTTTCTCAGAATTCTCCA TGG (reversed) Intergenic
No off target data available for this crispr