ID: 1040332996

View in Genome Browser
Species Human (GRCh38)
Location 8:46401766-46401788
Sequence AAAGGAGAGGCCTCCCTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040332989_1040332996 13 Left 1040332989 8:46401730-46401752 CCACCCAGAGGGGGGAGCACCAT No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332979_1040332996 29 Left 1040332979 8:46401714-46401736 CCTGAGCCTCTAGCCCCCACCCA No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332994_1040332996 -6 Left 1040332994 8:46401749-46401771 CCATGGAGAATTCTGAGAAAGGA No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332987_1040332996 15 Left 1040332987 8:46401728-46401750 CCCCACCCAGAGGGGGGAGCACC No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332992_1040332996 9 Left 1040332992 8:46401734-46401756 CCAGAGGGGGGAGCACCATGGAG No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332986_1040332996 16 Left 1040332986 8:46401727-46401749 CCCCCACCCAGAGGGGGGAGCAC No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332988_1040332996 14 Left 1040332988 8:46401729-46401751 CCCACCCAGAGGGGGGAGCACCA No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332982_1040332996 23 Left 1040332982 8:46401720-46401742 CCTCTAGCCCCCACCCAGAGGGG No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data
1040332991_1040332996 10 Left 1040332991 8:46401733-46401755 CCCAGAGGGGGGAGCACCATGGA No data
Right 1040332996 8:46401766-46401788 AAAGGAGAGGCCTCCCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040332996 Original CRISPR AAAGGAGAGGCCTCCCTATG AGG Intergenic
No off target data available for this crispr