ID: 1040335592

View in Genome Browser
Species Human (GRCh38)
Location 8:46414383-46414405
Sequence CACCGAAGGCTGTCCCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040335583_1040335592 3 Left 1040335583 8:46414357-46414379 CCAAGGGGGCTCTCCCATCCCAG No data
Right 1040335592 8:46414383-46414405 CACCGAAGGCTGTCCCGGGCGGG No data
1040335582_1040335592 4 Left 1040335582 8:46414356-46414378 CCCAAGGGGGCTCTCCCATCCCA No data
Right 1040335592 8:46414383-46414405 CACCGAAGGCTGTCCCGGGCGGG No data
1040335585_1040335592 -10 Left 1040335585 8:46414370-46414392 CCCATCCCAGAAGCACCGAAGGC No data
Right 1040335592 8:46414383-46414405 CACCGAAGGCTGTCCCGGGCGGG No data
1040335581_1040335592 7 Left 1040335581 8:46414353-46414375 CCTCCCAAGGGGGCTCTCCCATC No data
Right 1040335592 8:46414383-46414405 CACCGAAGGCTGTCCCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040335592 Original CRISPR CACCGAAGGCTGTCCCGGGC GGG Intergenic
No off target data available for this crispr