ID: 1040335943

View in Genome Browser
Species Human (GRCh38)
Location 8:46416035-46416057
Sequence AGGAGAAAAGGCAGCACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040335941_1040335943 -6 Left 1040335941 8:46416018-46416040 CCTTGAGATAGGCAAAGAGGAGA No data
Right 1040335943 8:46416035-46416057 AGGAGAAAAGGCAGCACTGCAGG No data
1040335938_1040335943 13 Left 1040335938 8:46415999-46416021 CCGCAGGGACTCAGGGAGACCTT No data
Right 1040335943 8:46416035-46416057 AGGAGAAAAGGCAGCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040335943 Original CRISPR AGGAGAAAAGGCAGCACTGC AGG Intergenic
No off target data available for this crispr