ID: 1040336486

View in Genome Browser
Species Human (GRCh38)
Location 8:46418657-46418679
Sequence CCCGCCCAGGACAGCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040336486_1040336495 25 Left 1040336486 8:46418657-46418679 CCCTCAGGGCTGTCCTGGGCGGG No data
Right 1040336495 8:46418705-46418727 GTGCCTGTGTCTCTCGCAGAAGG No data
1040336486_1040336492 3 Left 1040336486 8:46418657-46418679 CCCTCAGGGCTGTCCTGGGCGGG No data
Right 1040336492 8:46418683-46418705 TAAAACCTGTCCTTGGAGCAGGG No data
1040336486_1040336490 -4 Left 1040336486 8:46418657-46418679 CCCTCAGGGCTGTCCTGGGCGGG No data
Right 1040336490 8:46418676-46418698 CGGGCTCTAAAACCTGTCCTTGG No data
1040336486_1040336491 2 Left 1040336486 8:46418657-46418679 CCCTCAGGGCTGTCCTGGGCGGG No data
Right 1040336491 8:46418682-46418704 CTAAAACCTGTCCTTGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040336486 Original CRISPR CCCGCCCAGGACAGCCCTGA GGG (reversed) Intergenic
No off target data available for this crispr