ID: 1040336848

View in Genome Browser
Species Human (GRCh38)
Location 8:46420434-46420456
Sequence GCAAAAACAAGGCTGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040336839_1040336848 28 Left 1040336839 8:46420383-46420405 CCGCAGACTTTGGAGCAGGGTGC No data
Right 1040336848 8:46420434-46420456 GCAAAAACAAGGCTGCAGTGTGG No data
1040336842_1040336848 6 Left 1040336842 8:46420405-46420427 CCTGTGTCTCTTGCGGAAGGCCC No data
Right 1040336848 8:46420434-46420456 GCAAAAACAAGGCTGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040336848 Original CRISPR GCAAAAACAAGGCTGCAGTG TGG Intergenic
No off target data available for this crispr