ID: 1040339834

View in Genome Browser
Species Human (GRCh38)
Location 8:46434936-46434958
Sequence GACAGCAGGGTGGAGTGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040339834_1040339841 -6 Left 1040339834 8:46434936-46434958 CCCGACCACTCCACCCTGCTGTC No data
Right 1040339841 8:46434953-46434975 GCTGTCCTGTTTTCGATTGTGGG No data
1040339834_1040339842 -5 Left 1040339834 8:46434936-46434958 CCCGACCACTCCACCCTGCTGTC No data
Right 1040339842 8:46434954-46434976 CTGTCCTGTTTTCGATTGTGGGG No data
1040339834_1040339840 -7 Left 1040339834 8:46434936-46434958 CCCGACCACTCCACCCTGCTGTC No data
Right 1040339840 8:46434952-46434974 TGCTGTCCTGTTTTCGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040339834 Original CRISPR GACAGCAGGGTGGAGTGGTC GGG (reversed) Intergenic
No off target data available for this crispr