ID: 1040341323

View in Genome Browser
Species Human (GRCh38)
Location 8:46442608-46442630
Sequence CAGCCCACCCGGGACAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040341313_1040341323 24 Left 1040341313 8:46442561-46442583 CCTTCCGTGATAGACACAGGCAA No data
Right 1040341323 8:46442608-46442630 CAGCCCACCCGGGACAGCTGTGG No data
1040341318_1040341323 1 Left 1040341318 8:46442584-46442606 CCTGTTCCAAAGCCTGGGGCTTT No data
Right 1040341323 8:46442608-46442630 CAGCCCACCCGGGACAGCTGTGG No data
1040341314_1040341323 20 Left 1040341314 8:46442565-46442587 CCGTGATAGACACAGGCAACCTG No data
Right 1040341323 8:46442608-46442630 CAGCCCACCCGGGACAGCTGTGG No data
1040341319_1040341323 -5 Left 1040341319 8:46442590-46442612 CCAAAGCCTGGGGCTTTACAGCC No data
Right 1040341323 8:46442608-46442630 CAGCCCACCCGGGACAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040341323 Original CRISPR CAGCCCACCCGGGACAGCTG TGG Intergenic