ID: 1040341591

View in Genome Browser
Species Human (GRCh38)
Location 8:46443798-46443820
Sequence AAAACTAGGCCGCATGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040341591_1040341596 -4 Left 1040341591 8:46443798-46443820 CCCATGCCATGCGGCCTAGTTTT No data
Right 1040341596 8:46443817-46443839 TTTTCTCTTGTGCAGGCATTCGG No data
1040341591_1040341598 24 Left 1040341591 8:46443798-46443820 CCCATGCCATGCGGCCTAGTTTT No data
Right 1040341598 8:46443845-46443867 GACACAGGCACTCTGCTCCAAGG No data
1040341591_1040341597 9 Left 1040341591 8:46443798-46443820 CCCATGCCATGCGGCCTAGTTTT No data
Right 1040341597 8:46443830-46443852 AGGCATTCGGCGAGAGACACAGG No data
1040341591_1040341599 29 Left 1040341591 8:46443798-46443820 CCCATGCCATGCGGCCTAGTTTT No data
Right 1040341599 8:46443850-46443872 AGGCACTCTGCTCCAAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040341591 Original CRISPR AAAACTAGGCCGCATGGCAT GGG (reversed) Intergenic