ID: 1040355748

View in Genome Browser
Species Human (GRCh38)
Location 8:46617042-46617064
Sequence GAGGAGGGAGGCAGTTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040355733_1040355748 29 Left 1040355733 8:46616990-46617012 CCGGGGTGGCAGAGGAGTGAGAG No data
Right 1040355748 8:46617042-46617064 GAGGAGGGAGGCAGTTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040355748 Original CRISPR GAGGAGGGAGGCAGTTTAAG GGG Intergenic
No off target data available for this crispr