ID: 1040360467

View in Genome Browser
Species Human (GRCh38)
Location 8:46659436-46659458
Sequence TGCTCAAGCAAGCCACCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040360461_1040360467 9 Left 1040360461 8:46659404-46659426 CCACCTGCTTGGGCCACCACTGC No data
Right 1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG No data
1040360456_1040360467 21 Left 1040360456 8:46659392-46659414 CCGAGGACCTGCCCACCTGCTTG No data
Right 1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG No data
1040360455_1040360467 22 Left 1040360455 8:46659391-46659413 CCCGAGGACCTGCCCACCTGCTT No data
Right 1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG No data
1040360462_1040360467 6 Left 1040360462 8:46659407-46659429 CCTGCTTGGGCCACCACTGCCAC No data
Right 1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG No data
1040360459_1040360467 14 Left 1040360459 8:46659399-46659421 CCTGCCCACCTGCTTGGGCCACC No data
Right 1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG No data
1040360460_1040360467 10 Left 1040360460 8:46659403-46659425 CCCACCTGCTTGGGCCACCACTG No data
Right 1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG No data
1040360464_1040360467 -7 Left 1040360464 8:46659420-46659442 CCACTGCCACTGTCTGTGCTCAA No data
Right 1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG No data
1040360453_1040360467 30 Left 1040360453 8:46659383-46659405 CCCAGGGACCCGAGGACCTGCCC No data
Right 1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG No data
1040360463_1040360467 -4 Left 1040360463 8:46659417-46659439 CCACCACTGCCACTGTCTGTGCT No data
Right 1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG No data
1040360454_1040360467 29 Left 1040360454 8:46659384-46659406 CCAGGGACCCGAGGACCTGCCCA No data
Right 1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040360467 Original CRISPR TGCTCAAGCAAGCCACCTGT GGG Intergenic
No off target data available for this crispr