ID: 1040360503 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:46659753-46659775 |
| Sequence | CATTGTTACCACAGCATAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1040360503_1040360504 | 26 | Left | 1040360503 | 8:46659753-46659775 | CCAACTATGCTGTGGTAACAATG | No data | ||
| Right | 1040360504 | 8:46659802-46659824 | TTTTTATATATTTTTTGAGACGG | 0: 12 1: 208 2: 3641 3: 98833 4: 90543 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1040360503 | Original CRISPR | CATTGTTACCACAGCATAGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||