ID: 1040360503

View in Genome Browser
Species Human (GRCh38)
Location 8:46659753-46659775
Sequence CATTGTTACCACAGCATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040360503_1040360504 26 Left 1040360503 8:46659753-46659775 CCAACTATGCTGTGGTAACAATG No data
Right 1040360504 8:46659802-46659824 TTTTTATATATTTTTTGAGACGG 0: 12
1: 208
2: 3641
3: 98833
4: 90543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040360503 Original CRISPR CATTGTTACCACAGCATAGT TGG (reversed) Intergenic
No off target data available for this crispr