ID: 1040375185

View in Genome Browser
Species Human (GRCh38)
Location 8:46817917-46817939
Sequence TACAATCCCCAGTGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040375185_1040375189 22 Left 1040375185 8:46817917-46817939 CCCTGCTTCCACTGGGGATTGTA No data
Right 1040375189 8:46817962-46817984 AAAGATATGACTCTCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040375185 Original CRISPR TACAATCCCCAGTGGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr