ID: 1040377106

View in Genome Browser
Species Human (GRCh38)
Location 8:46836782-46836804
Sequence ACTCACCATCGCGGACGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040377106_1040377111 26 Left 1040377106 8:46836782-46836804 CCAGGGCGTCCGCGATGGTGAGT 0: 1
1: 0
2: 2
3: 6
4: 32
Right 1040377111 8:46836831-46836853 TGCTGCCGTGACTGGTTAATAGG No data
1040377106_1040377110 18 Left 1040377106 8:46836782-46836804 CCAGGGCGTCCGCGATGGTGAGT 0: 1
1: 0
2: 2
3: 6
4: 32
Right 1040377110 8:46836823-46836845 AGTGACAGTGCTGCCGTGACTGG No data
1040377106_1040377112 27 Left 1040377106 8:46836782-46836804 CCAGGGCGTCCGCGATGGTGAGT 0: 1
1: 0
2: 2
3: 6
4: 32
Right 1040377112 8:46836832-46836854 GCTGCCGTGACTGGTTAATAGGG No data
1040377106_1040377113 30 Left 1040377106 8:46836782-46836804 CCAGGGCGTCCGCGATGGTGAGT 0: 1
1: 0
2: 2
3: 6
4: 32
Right 1040377113 8:46836835-46836857 GCCGTGACTGGTTAATAGGGTGG No data
1040377106_1040377108 -7 Left 1040377106 8:46836782-46836804 CCAGGGCGTCCGCGATGGTGAGT 0: 1
1: 0
2: 2
3: 6
4: 32
Right 1040377108 8:46836798-46836820 GGTGAGTGATAGCACCGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040377106 Original CRISPR ACTCACCATCGCGGACGCCC TGG (reversed) Intergenic
900885731 1:5414073-5414095 ACTCATCATCACAGATGCCCAGG - Intergenic
912349528 1:108998393-108998415 ATTCACCATCTCGGCCTCCCAGG - Intronic
914095382 1:144540203-144540225 ACTCACCAGCGCGCACGACTAGG + Intergenic
914516584 1:148379480-148379502 ACTCACCAGCGCGCACGACTAGG + Intergenic
921304583 1:213782980-213783002 ACTCACCATTTCGGAAGCGCTGG + Intergenic
923281967 1:232452130-232452152 ACTCACCATCGTGGACTTCCTGG + Intronic
923866686 1:237947217-237947239 ACTCACCATCGCGGAAGGCCTGG - Intergenic
1083207547 11:61161591-61161613 ACACACGCTCGCGGCCGCCCGGG + Exonic
1083587037 11:63867744-63867766 TCTCACCATGGCTGACGCCGTGG + Intronic
1091240756 11:134050709-134050731 ACTCCCCGTCGCGGCCACCCGGG + Intergenic
1120367511 14:83589774-83589796 ACTCACCATCACGGAAGGCCTGG - Intergenic
1137270089 16:46897680-46897702 AGCCAACATCGGGGACGCCCAGG + Exonic
1143452221 17:7042924-7042946 CCTCACCAGCGAGGAGGCCCAGG + Exonic
1144259867 17:13507830-13507852 ACACACCATCGAGGACCCACAGG - Intronic
1147167307 17:38600489-38600511 ACTGACCATCTCTGAGGCCCAGG + Intronic
1152716950 17:81904838-81904860 AGTCACCATCGCGCTCCCCCAGG + Exonic
1161084463 19:2328381-2328403 CCTCACCTTCGCGGCCTCCCTGG + Exonic
1162024934 19:7888506-7888528 ACTCACCCTCGCGGCCCGCCCGG + Exonic
1163311434 19:16517256-16517278 ACTGACCATGGAGGATGCCCTGG + Exonic
1163776856 19:19224061-19224083 ACTGACCTTCGCTGAGGCCCAGG + Exonic
1168147993 19:54430267-54430289 ACTCCCCATTCCTGACGCCCAGG - Intronic
936860994 2:117020459-117020481 ACTCCCCATCGCGGAAGGCCTGG + Intergenic
937778628 2:125811173-125811195 ACTCACCATCGCGGAAGGCCTGG + Intergenic
939293489 2:140224862-140224884 ACTCACCATTGCAGAAGGCCTGG - Intergenic
1172771556 20:37385197-37385219 TCTCACCATCGTGGCCGCCCAGG + Intronic
1180890695 22:19286275-19286297 GCTCACCCTCGCAGACACCCTGG + Intronic
1180950923 22:19720185-19720207 GCTCACCATCGTGGACACGCCGG + Exonic
1181331902 22:22099138-22099160 CCTCACCATCACGGGGGCCCAGG + Intergenic
1185012467 22:48322166-48322188 ACTCACCCTCCCAGACACCCAGG - Intergenic
951887458 3:27538367-27538389 ACTCACCATCCCAGAAGCCTGGG - Intergenic
952819451 3:37473388-37473410 ACTCATCATCGCGGTCTTCCCGG - Exonic
966785215 3:183617352-183617374 ACTCACCATCTAGGACGCGCAGG - Intergenic
969466699 4:7361573-7361595 ATTCACCATCACTGACTCCCAGG - Intronic
986521293 5:8621098-8621120 TCACAGCATCGCGGACGGCCTGG + Intergenic
1006742669 6:36320566-36320588 AATCAGCATAGCGGACGCTCTGG - Intronic
1007160821 6:39790677-39790699 ATTCACCATCCCAGACTCCCTGG - Intergenic
1027541352 7:79470636-79470658 ATTCACCTTCTCGGACTCCCTGG + Intergenic
1040377106 8:46836782-46836804 ACTCACCATCGCGGACGCCCTGG - Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1060283177 9:122227403-122227425 ACTCACCATGGCGGGCGGCGCGG + Exonic
1197460157 X:126731013-126731035 ACTTACCATCGCGGAAGGCCTGG + Intergenic