ID: 1040383205

View in Genome Browser
Species Human (GRCh38)
Location 8:46893076-46893098
Sequence GAGTCACAGAACCTGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040383195_1040383205 23 Left 1040383195 8:46893030-46893052 CCAGTGAGGTGTCTCAATCCTTC No data
Right 1040383205 8:46893076-46893098 GAGTCACAGAACCTGGATGCTGG No data
1040383201_1040383205 1 Left 1040383201 8:46893052-46893074 CCTGTGGGCAGGACCCTGGAAGA No data
Right 1040383205 8:46893076-46893098 GAGTCACAGAACCTGGATGCTGG No data
1040383199_1040383205 5 Left 1040383199 8:46893048-46893070 CCTTCCTGTGGGCAGGACCCTGG No data
Right 1040383205 8:46893076-46893098 GAGTCACAGAACCTGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040383205 Original CRISPR GAGTCACAGAACCTGGATGC TGG Intergenic
No off target data available for this crispr