ID: 1040388859

View in Genome Browser
Species Human (GRCh38)
Location 8:46932939-46932961
Sequence CCAGAGCCCCAGGTGTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040388847_1040388859 29 Left 1040388847 8:46932887-46932909 CCAGCTGCTCACAGGACAACAGG No data
Right 1040388859 8:46932939-46932961 CCAGAGCCCCAGGTGTTGCAAGG No data
1040388854_1040388859 1 Left 1040388854 8:46932915-46932937 CCTTCTGGAGCAGCACAGAGGGG No data
Right 1040388859 8:46932939-46932961 CCAGAGCCCCAGGTGTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040388859 Original CRISPR CCAGAGCCCCAGGTGTTGCA AGG Intergenic
No off target data available for this crispr