ID: 1040395096

View in Genome Browser
Species Human (GRCh38)
Location 8:46991158-46991180
Sequence TGCTTTCTTTGAAAAAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040395096_1040395098 5 Left 1040395096 8:46991158-46991180 CCCTTGTTTTTTCAAAGAAAGCA No data
Right 1040395098 8:46991186-46991208 ACCATTTCTTGCAGTCATACAGG No data
1040395096_1040395100 6 Left 1040395096 8:46991158-46991180 CCCTTGTTTTTTCAAAGAAAGCA No data
Right 1040395100 8:46991187-46991209 CCATTTCTTGCAGTCATACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040395096 Original CRISPR TGCTTTCTTTGAAAAAACAA GGG (reversed) Intergenic
No off target data available for this crispr