ID: 1040395098

View in Genome Browser
Species Human (GRCh38)
Location 8:46991186-46991208
Sequence ACCATTTCTTGCAGTCATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040395097_1040395098 4 Left 1040395097 8:46991159-46991181 CCTTGTTTTTTCAAAGAAAGCAG No data
Right 1040395098 8:46991186-46991208 ACCATTTCTTGCAGTCATACAGG No data
1040395095_1040395098 6 Left 1040395095 8:46991157-46991179 CCCCTTGTTTTTTCAAAGAAAGC No data
Right 1040395098 8:46991186-46991208 ACCATTTCTTGCAGTCATACAGG No data
1040395096_1040395098 5 Left 1040395096 8:46991158-46991180 CCCTTGTTTTTTCAAAGAAAGCA No data
Right 1040395098 8:46991186-46991208 ACCATTTCTTGCAGTCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040395098 Original CRISPR ACCATTTCTTGCAGTCATAC AGG Intergenic
No off target data available for this crispr