ID: 1040397872 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:47016649-47016671 |
| Sequence | GGTTAAAGAGAGACCAAGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1040397872_1040397878 | -1 | Left | 1040397872 | 8:47016649-47016671 | CCCACCTTGGTCTCTCTTTAACC | No data | ||
| Right | 1040397878 | 8:47016671-47016693 | CCACTGGAGAAATCAGAGTGAGG | No data | ||||
| 1040397872_1040397879 | 12 | Left | 1040397872 | 8:47016649-47016671 | CCCACCTTGGTCTCTCTTTAACC | No data | ||
| Right | 1040397879 | 8:47016684-47016706 | CAGAGTGAGGACATCTTTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1040397872 | Original CRISPR | GGTTAAAGAGAGACCAAGGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||