ID: 1040397873

View in Genome Browser
Species Human (GRCh38)
Location 8:47016650-47016672
Sequence GGGTTAAAGAGAGACCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040397873_1040397878 -2 Left 1040397873 8:47016650-47016672 CCACCTTGGTCTCTCTTTAACCC No data
Right 1040397878 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data
1040397873_1040397879 11 Left 1040397873 8:47016650-47016672 CCACCTTGGTCTCTCTTTAACCC No data
Right 1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040397873 Original CRISPR GGGTTAAAGAGAGACCAAGG TGG (reversed) Intergenic
No off target data available for this crispr