ID: 1040397877

View in Genome Browser
Species Human (GRCh38)
Location 8:47016671-47016693
Sequence CCTCACTCTGATTTCTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040397877_1040397879 -10 Left 1040397877 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data
Right 1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG No data
1040397877_1040397880 13 Left 1040397877 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data
Right 1040397880 8:47016707-47016729 CACTAGAGATATGAATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040397877 Original CRISPR CCTCACTCTGATTTCTCCAG TGG (reversed) Intergenic
No off target data available for this crispr