ID: 1040397878

View in Genome Browser
Species Human (GRCh38)
Location 8:47016671-47016693
Sequence CCACTGGAGAAATCAGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040397873_1040397878 -2 Left 1040397873 8:47016650-47016672 CCACCTTGGTCTCTCTTTAACCC No data
Right 1040397878 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data
1040397872_1040397878 -1 Left 1040397872 8:47016649-47016671 CCCACCTTGGTCTCTCTTTAACC No data
Right 1040397878 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data
1040397870_1040397878 22 Left 1040397870 8:47016626-47016648 CCAAATGCTGGGGAAGCTGAACA No data
Right 1040397878 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data
1040397874_1040397878 -5 Left 1040397874 8:47016653-47016675 CCTTGGTCTCTCTTTAACCCACT No data
Right 1040397878 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data
1040397868_1040397878 24 Left 1040397868 8:47016624-47016646 CCCCAAATGCTGGGGAAGCTGAA No data
Right 1040397878 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data
1040397869_1040397878 23 Left 1040397869 8:47016625-47016647 CCCAAATGCTGGGGAAGCTGAAC No data
Right 1040397878 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040397878 Original CRISPR CCACTGGAGAAATCAGAGTG AGG Intergenic
No off target data available for this crispr