ID: 1040397879

View in Genome Browser
Species Human (GRCh38)
Location 8:47016684-47016706
Sequence CAGAGTGAGGACATCTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040397873_1040397879 11 Left 1040397873 8:47016650-47016672 CCACCTTGGTCTCTCTTTAACCC No data
Right 1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG No data
1040397877_1040397879 -10 Left 1040397877 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data
Right 1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG No data
1040397874_1040397879 8 Left 1040397874 8:47016653-47016675 CCTTGGTCTCTCTTTAACCCACT No data
Right 1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG No data
1040397876_1040397879 -9 Left 1040397876 8:47016670-47016692 CCCACTGGAGAAATCAGAGTGAG No data
Right 1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG No data
1040397872_1040397879 12 Left 1040397872 8:47016649-47016671 CCCACCTTGGTCTCTCTTTAACC No data
Right 1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040397879 Original CRISPR CAGAGTGAGGACATCTTTCT TGG Intergenic
No off target data available for this crispr