ID: 1040397880

View in Genome Browser
Species Human (GRCh38)
Location 8:47016707-47016729
Sequence CACTAGAGATATGAATAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040397876_1040397880 14 Left 1040397876 8:47016670-47016692 CCCACTGGAGAAATCAGAGTGAG No data
Right 1040397880 8:47016707-47016729 CACTAGAGATATGAATAAAATGG No data
1040397877_1040397880 13 Left 1040397877 8:47016671-47016693 CCACTGGAGAAATCAGAGTGAGG No data
Right 1040397880 8:47016707-47016729 CACTAGAGATATGAATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040397880 Original CRISPR CACTAGAGATATGAATAAAA TGG Intergenic
No off target data available for this crispr