ID: 1040402721

View in Genome Browser
Species Human (GRCh38)
Location 8:47068473-47068495
Sequence ATGCCCTCCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040402721_1040402723 5 Left 1040402721 8:47068473-47068495 CCTTCACTCTTCTAGGAGGGCAT No data
Right 1040402723 8:47068501-47068523 GTTAGGTCCTATTTTTCCCATGG No data
1040402721_1040402726 21 Left 1040402721 8:47068473-47068495 CCTTCACTCTTCTAGGAGGGCAT No data
Right 1040402726 8:47068517-47068539 CCCATGGTTTAAAGTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040402721 Original CRISPR ATGCCCTCCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr