ID: 1040405123

View in Genome Browser
Species Human (GRCh38)
Location 8:47093752-47093774
Sequence TCCACCTTGAATTAATTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040405123_1040405127 11 Left 1040405123 8:47093752-47093774 CCCAAAAATTAATTCAAGGTGGA No data
Right 1040405127 8:47093786-47093808 AACCTAAGACCTGAAAACACTGG No data
1040405123_1040405129 17 Left 1040405123 8:47093752-47093774 CCCAAAAATTAATTCAAGGTGGA No data
Right 1040405129 8:47093792-47093814 AGACCTGAAAACACTGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040405123 Original CRISPR TCCACCTTGAATTAATTTTT GGG (reversed) Intergenic
No off target data available for this crispr