ID: 1040408480

View in Genome Browser
Species Human (GRCh38)
Location 8:47132776-47132798
Sequence TGGGCTTCCCCCCGCCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040408480_1040408487 1 Left 1040408480 8:47132776-47132798 CCCACCCGGCGGGGGGAAGCCCA No data
Right 1040408487 8:47132800-47132822 ACCCACCCCACGCCCACCCAGGG No data
1040408480_1040408486 0 Left 1040408480 8:47132776-47132798 CCCACCCGGCGGGGGGAAGCCCA No data
Right 1040408486 8:47132799-47132821 CACCCACCCCACGCCCACCCAGG No data
1040408480_1040408497 19 Left 1040408480 8:47132776-47132798 CCCACCCGGCGGGGGGAAGCCCA No data
Right 1040408497 8:47132818-47132840 CAGGGAAGCCCACGCCCACCTGG No data
1040408480_1040408499 21 Left 1040408480 8:47132776-47132798 CCCACCCGGCGGGGGGAAGCCCA No data
Right 1040408499 8:47132820-47132842 GGGAAGCCCACGCCCACCTGGGG No data
1040408480_1040408498 20 Left 1040408480 8:47132776-47132798 CCCACCCGGCGGGGGGAAGCCCA No data
Right 1040408498 8:47132819-47132841 AGGGAAGCCCACGCCCACCTGGG No data
1040408480_1040408500 26 Left 1040408480 8:47132776-47132798 CCCACCCGGCGGGGGGAAGCCCA No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040408480 Original CRISPR TGGGCTTCCCCCCGCCGGGT GGG (reversed) Intergenic
No off target data available for this crispr